Bella! Talks - Tumblr Posts
holy shit i leave tumblr unattended for a second and bro starts getting attacked by anons... your writing is so tasty please don't listen to them 😭 99% of anon hate I've seen my oomfs/blogs i follow in general is literally irrational and stupid..
HAHAH I LOVE U BAE💜💜💜🔥🔥
I think everyone thats talking about you being racist are stupid as fuck but it IS a little weird to ship members of a group.. 😬 Just be aware that you are always going to receive criticism for that.
i am aware ? 💜
get out of anon if you’re gonna say something! 👍 instead of criticizing someone for doing something they like and instead of objectifying something they do by telling them they’re “fetishizing” a race is weird. because they’re doing nothing like that. you know absolutely nothing about them so stop trying to make it seem like you do. 😭 you’re weird, jobless, and need a job application. i got one for you anon! it’s at mcdonald’s, where your ass NEEDS to be working. there’s no way you can take time out your day and just criticize someone for doing something they like, weirdo alert! instead of staying anonymous how about you say it to the persons face, it’s not a good look on you!!!! because her writing actually has made people happy, unlike you. because, oh! you don’t do anything! you sit in your room on your computer and degrade people for their hobbies. yikes! go get my job application off my desk anon! because you need it, you need it because you have nothing to do with your time. stop trying to tear down other people with your insecurities. thanks anon!
anon needs to learn how to enjoy the fine arts of piwon smut…i’ll help them write their application!
Bella hate will NOT be tolerated! You all will start to cough in 2 days
-🫧
mean anon when bubble anon curses them….
turning off my inbox for the night cause why did an anon just tell me their fantasies of unspeakable acts towards me hello.😭
Bella 🧍🏻♀️ have you ever thought about making SpicyChat.ai characters too? It’s like C.ai but allows smut 👀
Xoxo 🕊️
P.s whoever was mean anon watch out I’m waiting for you in your faucet 😡
hermmmm….id have to get the app and learn a little more about it! if i liked it enough, sure!! ☺️☺️
Omfg these hate anons have no lives… keep writing and ignore these people PLEASE 🙏🏻🩷
-🍎
I LOVE YOU APPLE ANON!!! 💜💜💜
hey bae how are u doing after all that anon shite 😭 I hope ur feeling better 🫶 from titty sucker soul anon (AHHAH maybe I need an emoji)
IM DOING GOOD!! i’ve been moving these past few days and just got wifi back💔 it’s been torture omg. but thank you!!! and you def need an emojiiii :3
just published my intro post for my blog ong your words encouraged me to just get out of my own head and give it a go. thank you so much bella, i really appreciate it~ wish me luck 🫣
~💄
OMG LIPSTICK ANON yaaay!!!! i hope i see u sooooon!!! keep it upppp😝😝😝😝 love u
hey so that track teaser Piwon released has me fucking crazy, seob in the baggy jorts and baggy white shirt and the (what I think) is mumble rapping (doesn't matter cuz I'd go crazy no matter what) has me weak at the knees, maybe I'm ovulating or maybe it's just seob but FUCK I haven't seen any1 talk abt it yet like???? It lowk reminds me of dealer!seob.. like the way the teaser pic is in like an empty parking garage like.. or overly egotistical wannabe rapper (Yk those wannabe SoundCloud rappers? It's giving that in the best way possible) I am so excited for sad song when it comes out I'll cum (joking.. ish) also he's gotten a bit meatier?? Like he isn't skin and bones he's like AHHHHH close the gyms bc why does he lowk have as n shit.. everything abt him has me foaming at the mouth
Sorry for the hella long rant abt seob😭😭
no i agree. and i’m also ovulating. dealer seob is actually too good i want him to drag me into a dirty warehouse and fuck me open yup yup
mv....i-intak b- bl- blood on hhis face
no literally….genuinely tweaking and losing my minf IM SERIOUS I CANT TAKE IT i love a bloody man more than i love myself. bloody intak fist fighting me when
jongseob gives me the vibes of someone who'll ket there gf squirt directly into his moith :3 hes so perverted me thinks
ugh he’s soooo dirtyyyy literally like covering ur pussy w his mouth, letting u squirt into it and spitting it out onto ur pussy only to lick it up again 😵💫 he’s a lil perv i love him
call me crazy….maybe the world isn’t ready for this….but watersports + jongseob….LETS DISCUSS…
seob pissing in ur cunt cause he wants to make u feel humiliated 😵💫 or maybe even hybrid seob doing it to mark his territory!! lets u piss in his mouth…probably asks you to do it tbh
omg he forces u to drink lots of water and when u have to use the bathroom he just pulls up into his lap ^.^ tells u how pretty u are while he presses down on ur tummy!! :( when you tell him that you have to pee, he’s like “it’s okay baby, just make a mess on me. i don’t mind,” 😵💫😵💫
just realized i got off topic pretend i didn’t ☺️
boypussy piwon..
yeah let’s discuss….
boypussy piwon living in the dorm together and realizing they all have pussies!! maybe the shower head was dangling or they find each others vibrators and whatnot….soooo good yum yummy
but they find out and they’re all lowkey like idk how to use this thing?? like :( scissoring fest me thinks….
seob on top of sho, grinding their puffy cunts into each other 😵💫 moaning and crying cause it feels soooo good!! ji under intak while kyo and theo 69…ugh need
it would be too good they are just mindlessly grinding n lapping at each others cunts but it feels too good to stop! sho grabbing seob w shaky hands n talking about how good seobs pussy feels against his :(
all of them are soooo pretty, flushed and panting and rolling their hips up against each other 😵💫 theo would have to stop eating kyos cunt cause he just can’t take it!! kyos tongue feels so good fucking his pussy :(
ji and tak would be sooo fucked out…grinding their sticky cunts against each other like animals, not caring how many times they’ve came 💔
if they were with reader….i think things would go smoother!! more of an educational idea for the first time…theyre a bit inexperienced me thinks. but they loooove the thought of a double dildo!! they’d all be so desperate, babbling about how deep it is and how good it feels :( squirting against ur pussy and grinding against the gross sticky mess :((
Bonjour! Can I be an anon using 🩰? A kiss directly from a Brazilian/French woman for you! 🇧🇷💚
YES you can!! hello ballerina anon ☺️🩰 MWUAH i love the brazilian/french kisses!!! 🩷🩷
this might be a stretch but would you write jongseob scat play ? (˶˃ ᵕ ˂˶) .ᐟ.ᐟ btw love your work you are a mastermind !!
please read here. i will not write scat, im sorry! if there is anything else that may tickle your fancy, lmk 😉 thank you for liking my work anon!
did someone actually ask for scat play..
yes, unfortunately haha. no hate to them though, everyone likes something different! ☺️🩷
i hate you so much i’m doxxing your genetic sequence ATGCTCTTAGGTCTAGATCTATGGAACTCATCCATGCTCTTAGGTCTAGATCTATGGAACTCATCCGGATCCATTGGATTCTAATGCTCTTAGGTCTAGATCTATGGAACTCATCCATGCTCTTAGGTCTAGATCTATGGAACTCATCCATGCTCTTAGGTCTAGATCTATGGAACTCATCCGATTTACTCGCTAATCC
what does this mean ?😭
i love you sm bella i’m taking your genetic sequence you will be nothing yet a mere cell
hey i love you too anon what does this mean? purple heart emoji
